-
What Does PhD Stand For?
Continue ReadingWhat Does PhD Stand For?
The doctorate or PhD degree is the highest academic degree available. For a thesis that makes an original contribution to your subject area, the title usually requires three to four years of full-time work.
This article defines a doctorate, what it entails and what you need to know before applying for a doctoral project or enrolling in a doctoral program.
PhD Meaning
A PhD is a globally recognized postgraduate academic degree awarded by universities and higher education institutions to a candidate who has submitted a thesis or dissertation, based on extensive and original research in their chosen field.
Doctors of Philosophy have the ability to become legends. Is it true that only geniuses can help them? Do you want to learn something amazing? Does your academic position depend on your degree?
Even the full title of “Doctor of Philosophy” is a little confusing.
Are you planning on becoming a doctor when you grow up? This isn’t a medical situation, though. Is learning philosophy a requirement? But (not unless you want to).
Before we go any further, let’s define “PhD” and what it entails.
What is a PhD?
A doctor of philosophy (PhD) is a degree given to those who have completed advanced studies in philosophy.
PhD is one of the highest-ranking degrees available. PhD is an abbreviation of the Latin term (Ph) ilosophiae (D) octor. Traditionally, the term “philosophy” has been used to refer to the ancient Greek definition of the word, which approximately translates to “lover of wisdom.”
What is a doctorate and how does it differ from a master’s degree?
Every degree leading to a doctorate is referred to as a doctoral degree. To be considered for this, you must have completed advanced research which is instrumental in adding expertise in your field. As a result, you get the title “Doctor”, hence the name.
So how does a PhD differ from a PhD?
No, a doctorate is called a doctorate.
Doctorates are the most common type of doctorate and are awarded in almost all subjects at universities worldwide. Other doctorates are more specialized or geared more towards practical and professional purposes. In principle, all doctorates are doctorates, but not all doctorates are doctorates.
Is Master's Degree Required for a PhD?
Certainly not. Students in the Arts and Humanities frequently earn an MA (Master of Arts) before beginning a PhD to gain research skills and techniques. Students majoring in Science, Technology, Engineering, and Mathematics (STEM) don’t always require an MS/MSc (Master of Science) to pursue a PhD because they’ll get lab experience and other abilities throughout their undergraduate studies.
Whether or not a Master’s degree is required for a PhD varies by country. As a substitute for their own ‘honours year,’ Australian PhDs may be required to complete a Master’s degree (where students work on research). A Master’s degree is frequently included in PhD programmes in the United States.
The PhD's Beginnings
The PhD is not an Ancient Greek degree, despite its name. It’s a lot more recent development instead. Along with the contemporary research university, the PhD as we know it was developed in nineteenth-century Germany.
Higher education had typically focused on mastery of an existing body of scholarship, with a Masters degree being the highest academic rank attainable.
The PhD degree was introduced to recognise people who demonstrated the necessary abilities and expertise as the focus shifted more toward the production of new knowledge and ideas.
The (PhD) Doctoral Procedure: What is Required for a Doctorate?
The doctorate usually lasts three to four years full-time or five to six years part-time.
Unlike most master’s programs (or all undergraduate programs), a PhD a mere research degree, but that doesn’t mean you’ll be locked up in a library or laboratory for years. and varied assessment with many different components.
While the second or third year of a particular degree is very similar to the first (with more modules and courses at a higher level), a doctorate goes through several phases.
A typical PhD entails the following:
Conducting a literature review (a survey of current scholarship in your field).
Performing original research and compiling your findings.
Creating a thesis that summarises your findings.
Putting your thesis together and turning it in as a dissertation.
In an oral viva voce exam, you must defend your thesis.
These stages differ slightly between disciplines and universities, but they generally follow the same pattern during the course of a standard three-year full-time PhD.
A PhD Student's Ist Year
The first year of a PhD is all about establishing yourself as a researcher and gaining a firm foundation in current literature on your field.
You’ll meet with your supervisor for the first time to discuss your research proposal and a plan of action.
Performing your literature review is probably certainly the initial stage in this process. You’ll start by surveying and analysing current scholarship with the help of your supervisor. This will aid in situating your study and ensuring the originality of your work.
Your literature review will serve as a reasonable starting point for the start of your own study and data collection. This could entail devising and carrying out tests, or digging through a stack of primary sources.
It’s possible that the year will end with an MPhil upgrade. When PhD students are first registered for an MPhil degree and then ‘upgraded’ to PhD candidates after making sufficient progress, this happens.
In an upgrade exam, you’ll submit information from your literature review or a draught of your research findings, which you’ll discuss with members of your department. If all goes well, you’ll continue your research as a PhD student.
A PhD Student's IInd Year
The majority of your core research will likely take place in your second year. Depending on your field, the procedure will vary, but the major focus will be on acquiring data from experiments, archival research, surveys, and other sources.
The thesis (or argument) you base your study on will evolve as well. You may even start drafting chapters or other parts of your dissertation now.
Your supervisor and you will continue to meet on a regular basis. They’ll keep an eye on your progress, give you input on your ideas, and most likely read any draughts you submit.
The second year is also a critical period in your academic growth. You’ll be well-versed in current research and have started collecting data or developing your own ideas.
However, you will not yet be faced with the difficult and time-consuming work of completing your dissertation. As a result, this stage of your PhD is an excellent opportunity to consider giving talks at academic conferences, obtaining teaching experience, or even selecting material for publishing in a peer-reviewed journal.
A PhD Student's IIIrd Year
The writing up period of a PhD is commonly referred to as the third year. This is traditionally the last stage of your PhD, when you’ll be tasked with compiling your findings and refining your thesis into a dissertation.
In reality, it isn’t always that simple. It’s fairly uncommon for PhD students in their final year to be fine-tuning studies, collecting data, or tracking down a few extra sources. This is especially true if you devote a portion of your second year to professional development.
In fact, some students spend the whole fourth year or a portion of it doing their dissertation. The terms of your enrolment – and maybe your PhD financing – will determine whether you are able to do so.
However, you will eventually be required to write your thesis and submit your dissertation. This is a process in which your supervisor will be heavily involved. They’ll go over your final draught with you and let you know when they believe your PhD is ready to submit.
The only thing left is your final viva voce oral examination. This is a formal discussion and defence of your thesis, with at least one internal and external examiner in attendance. It’s usually the only way to evaluate a PhD candidate. You’ve completed the task once you’ve passed!
What is it like to be a doctorate?
The “stages” mentioned above might be thought of as a basic “roadmap” for a PhD, but the real “travel” you will take as a research student will include many additional intriguing spots, some optional destinations, and at least one very significant partner.
PhD and Research
As a doctorate student, you spend the majority of your time researching your PhD thesis, which is understandable. However, this term can refer to a surprising number of activities.
When you’re supervising experiments or researching literature, the stereotype of a student working in a laboratory or sitting in a library with a stack of books can be true. However, your PhD can take you much further.
It’s possible that you’ll find yourself visiting archives or facilities to study data or look at rare source materials. You could even be able to spend a length of time ‘in residence’ at a research centre or another institution outside of your university.
In addition, research is not a solo endeavour. You’ll meet with your supervisor on a regular basis, but you may also collaborate with other students on occasion.
This is especially true if you’re part of a larger laboratory or workshop group working on a comparable issue. Collaboration among students working on various projects is also prevalent. You can join groups that plan events and presentations, or you can work on smaller, mutually beneficial projects on your own.
Many universities also organise in-house presentations and panel discussions, which are a fantastic way to meet and provide feedback to other PhD students in your field.
Cooperation with Your Supervisor
All doctoral projects are carried out under the direction of at least one academic supervisor, who will be your main contact person and supervisor for the entire duration of the doctorate.
Your supervisor will be an expert in your general research area, but he will never have done research on your exact topic (if so, your project would not be original enough for a PhD).
It is better to see your manager as a mentor than a teacher. As a PhD student, you are now an independent and original scientist who pushes the boundaries of your subject beyond what is currently known (and taught) about it.
You are doing all of this for the first time, of course. It’s not your boss. They’ll understand what it takes to run a three-year advanced research project (or more).
They’ll know how to succeed, but they’ll also be aware of what could go wrong and how to recognise the warning signs before it happens. Most importantly, they will have the time and experience to listen to your ideas and provide comments and support as you work on your thesis.
The specifics of supervision differ between universities and projects:
A supervisor is often the primary investigator on a larger research project in Science and Technology, with responsibility for a laboratory or workshop that includes numerous PhD students and other researchers.
A supervisor’s research in Arts and Humanities topics is more distinct from that of their pupils. They may supervise multiple PhDs at the same time, but each project is treated as an independent entity.
Furthermore, PhD candidates are increasingly likely to have two (or more) supervisors. The former is in charge of your academic research, while the latter is in charge of supervising your doctoral thesis to ensure that you complete your education on time.
As part of your project’s strategy Regardless of how you are cared for, you will have regular meetings to discuss the job and assess your progress.
Your supervisor will offer you with feedback on your work throughout your doctorate and will play an important role as you near graduation: they will read your final draught, support you in choosing an external reviewer, and (hopefully) accompany you for a celebratory drink.
PhD: a Education, Networking, and Communication
The doctorate is traditionally understood as a training process that prepares students for a scientific career. As such, it often includes the opportunity to acquire additional skills and experience that are an important part of an academic curriculum.
After all, scientists don’t just do research; they also teach students, manage departments and supervise doctoral students. The modern doctorate is also considered a flexible degree.
Not all doctoral students end up in higher education. Many pursue alternative careers related to their area of expertise or based on the advanced research skills developed by their doctoral thesis. This is also reflected in the doctoral programs. Many today place great emphasis on transferable skills or include special training sessions designed to help students communicate and apply their research outside of class.
All of this means that relatively few doctoral degrees concentrate exclusively on researching and writing a dissertation.
What are the Options During PhD?
During your PhD, you will almost certainly do some (or all) of the following:
i. Teaching
PhD students often have the opportunity to train university students in their respective institutions.In most cases, this involves leading classroom exercises in small groups, demonstrating methods and experiments, and offering tutoring. Work is often paid and formal training and assessment are becoming more common.
ii. Conference Presentation
As a PhD student, you are at the forefront of your field, doing unique research and generating new knowledge. This indicates that your research is of interest to other scientists and that your results are worth presenting at scientific conferences.
This is worth doing regardless of your career plans. You will develop transferable speaking and presentation skills, receive feedback on your results, and be recognized as an expert in your field. Conferences are also good places to network. with other students. and academics.
iii. Publication
In addition to presenting your research, you have the opportunity to publish your work in scientific journals, books or other media.
This can be a challenging process. Your work will be judged to the same high standards as that of other scientists and will usually go through extensive peer-review processes.
But it’s also very rewarding. Seeing your work “in print” is an incredible endorsement of your dissertation and a definite boost to your academic resume.
iv. Public Relations and Communication
Scientific work may be associated with the myth of the “ivory tower,” an isolated community of experts focused on obscure topics of little interest outside of the university, but this is nowhere near the case.
The “impact” of research and its wider public benefits are increasingly emphasized, and funding decisions are made accordingly.
Fortunately, as a doctoral student there are many ways to test public participation. Universities often participate in local events and initiatives to communicate the benefits of their research, from workshops at local schools to lectures and public presentations.
Some PhD programmes incorporate structured instruction to assist students with tasks like the ones listed above.
Your supervisor may also be able to assist you by pointing you in the direction of acceptable conferences and public engagement opportunities, as well as participating you in appropriate university events and public engagement efforts.
These experiences will be crucial to your growth as a researcher, and will increase the value of your PhD regardless of your future aspirations.
What is the Purpose of a PhD, and Who Should Pursue One?
So now you know what a PhD is, what it entails to complete one, and what you might accomplish while doing one. Only one more question remains: should you pursue a PhD?
We’re afraid we can’t help you with this.
A PhD is an extremely demanding and specialised task. After you’ve earned your undergraduate degree, you’ll need to put in at least three years of effort and attention (and probably a Masters degree too).
During those years, you’ll need to sustain yourself, and while you’ll be honing an outstanding set of abilities, you won’t be directly developing in a profession.
A PhD, on the other hand, is extremely satisfying. It’s your chance to add to the total of human knowledge by producing work that other scholars can (and will) expand on in the future. There is no such thing as a useless PhD, no matter how obscure your topic appears.
A PhD is something to be quite proud of as well. Only a small percentage of people continue on to conduct academic work at this level. Whatever you do with your PhD, you’ll have an excellent qualification – and a title to go along with it. In addition, non-academic careers and professions are increasingly appreciating the unique talents and experience that a PhD provides.
Should I do PhD?
Elsewhere in this section, you can find more advice about the value of a doctorate and good reasons to study one. Talk to your teachers / tutors.
After completing a PhD, the best thing to do is to ask who has obtained a PhD. Ask the staff at your current or former university about their experiences in doctoral research – what they enjoyed, what they didn’t and what advice they could give.
If you are considering a PhD for an academic career, ask about it too. Are the job prospects in your area good? And what is it really like to work at a university?
Speak with PhD students who are currently enrolled in programmes
Do you want to know how it feels to be a PhD student right now? Or how it is to conduct research at a specific institution? Inquire with an expert. Current PhD students were in your shoes a year or two ago, and the majority of them will gladly answer your queries. If you can’t meet any students in person, head over to the Postgraduate Forum, where you’ll find lots of students willing to talk about postgraduate research.
Examine the projects and programmes that have been advertised
This may appear to be an odd recommendation. After all, you’ll only be studying one PhD, so why waste time learning about others? Examining the specifics of other PhD projects, on the other hand, is a terrific approach to obtain a general idea of what PhD research entails. You’ll learn what PhDs have in common and what kinds of opportunities you might have.
Take a Look at Funded PhD Programs
Finally, on the VacancyEdu.com website, you can look at some of the fully funded PhD programs as well as CV template, cover letters etc.
We’ve looked at some of the benefits (and drawbacks) of pursuing a PhD, as well as how a doctorate might help you advance in your job. You may learn more about general areas of doctorate studies, such as working with a supervisor or writing your dissertation, by reading our in-depth look at a typical PhD journey. We regularly publish new articles; the best way to keep up with them is to subscribe to our free PhD opportunity email.
Share
Similar Post:
-
Cytidine Monophosphate: Definition, Types, and Examples
Continue ReadingWhat is Cytidine Monophosphate?
Cytidine monophosphate is nucleotide and can be written as C9H14N3O8P and these nucleotides comprises of 3 parts; phosphate group, sugar of 5C and a nucleobase.
Sugar can be either ribose or deoxyribose. DNA is made from the deoxyribose sugar and RNA from ribose sugar. The components of nucleic acids are the nucleotides.
The nucleic acid backbone is formed from phosphate and the sugar molecule and the synthesis takes place in 5’-3’ direction, although the two strands run in the opposite direction, so that they can bond with each other due to complementary bases.
Nucleotides can be linear as well as in cyclic form, where the phosphate group is bounded to the hydroxyl group of sugar. Phosphate group and nucleotide forms nucleoside.
Thus, to the sugar molecule, when a single phosphate group is attached it is called as nucleoside monophosphate and when two phosphate groups, it is called as nucleoside diphosphate and similarly when 3, it is called as nucleoside triphosphate.
Nucleoside can be deoxyribonucleoside or ribonucleoside. On the basis of pentose sugar, thus ribonucleoside consists of ribose sugar with nucleoside and these nucleosides can be adenine, guanine, cytosine and thymine.
Similarly, deoxyribonucleoside may have nucleosides like adenine, guanine, cytosine and thymine, in which adenine pairs with thymine and cytosine with guanine.
Pyrimidine and purine are two types of nucleoside where pyrimidine is single stranded and purine is double stranded.
Cytidine Monophosphate Structure
Cytidine monophosphate is an organic compound which contains ribose sugar, phosphate group, and nucleosides. As cytidine is bound to the ribose sugar, it is a pyrimidine base, with one phosphate molecule attached to the nucleobases.
Cytidine Monophosphate Synthesis
Through de-novo synthesis, CMP can be generated. Pyrimidine like cytosine can be formed through various steps. Carbamoyl phosphate synthetase forms carbamoyl phosphate which gets transformed to carbamoyl aspartate and then to dihydroorotate which will further be oxidized to orotate, which interacts with PRPP to form orotidine-5- monophosphate, which is transformed into pyrimidine.
For the synthesis of uridine mono phosphate, from OMP carbon dioxide is removed by OMP decarboxylase. Uridine mono phosphate is phosphorylated to form Uridine di phosphate and similarly triphosphate, which when aminated forms cytidine triphosphate by CTP synthetase.
Cytidine monophosphate is formed when CTP is disintegrated. Breakdown of further CMP results in formation of cytosine and end-products like ammonia, CO2 and Beta-alanine.
Through salvage pathway cytosine can be re-obtained. Through deamination, cytosine is transformed to uracil and then to uridine with uridine phosphorylase and further with the help of nucleoside kinase, uridine is transformed to UMP.
Cytidine Monophosphate Function
Monomer of RNA is cytidine monophosphate, where CMP is reduced to deoxycytidine monophosphate and phosphorylated to form cytidine diphosphate by CMP kinase and when again phosphorylated it produces cytidine triphosphate.
Cytidine Monophosphate Citations
- Bacterial CMP-sialic acid synthetases: production, properties, and applications. Appl Microbiol Biotechnol . 2008 Oct;80(5):757-65.
- Cytidine 3′,5′-cyclic monophosphate: a third cyclic nucleotide intracellular mediator? Biochem Soc Trans . 1992 May;20(2):469-74.
- Cyclic cytidine 3′,5′-monophosphate (cCMP) in cell regulation. Mol Cell Endocrinol . Nov-Dec 1982;28(3):373-85.
Share
Similar Post:
-
PhD Career: What are the Career Option?
Continue ReadingPhD Career: What are the Career Option?
Achieving a PhD is rewarding as it opens the door to numerous career opportunities. In addition to it being the highest academic degree, it is expected to teach you life lessons and soft skills, and train you to analyze situations and solve problems.
Therefore, what you do in life after earning a PhD pretty much depends on how you want to utilize your experience and knowledge gained so far.
PhD Career: What are Options?
If you choose to carry out research in your field of interest or in the subject area in which you have expertise, then going on to do post-doctoral research is something many PhD graduates opt for.
A post-doctoral experience gives you an opportunity to work under the supervision of an experienced faculty, but with expectedly more independence than you had during PhD, especially because by the end of PhD, you are more able to guide your own research.
Also, a post-PhD experience is considered a plus in many job opportunities that you might want to pursue thereafter. One of them is that of a professor.
These positions in academic institutes or universities are meant for people who want to continue contributing to their field of interest by doing active research, often while guiding future researchers as their students.
An additional opportunity that you get in these positions is that of teaching. But if you are somebody who wants to just pass on the knowledge to younger generations and not participate in core research, then after PhD, you could look for teaching positions in schools, colleges, and other educational institutes.
On the other hand, if your passion lies in research and you are not so much fond of teaching, then you are best suited for research laboratories and government research agencies.
For instance, many companies (such as in pharma, drug development, aerospace, finance, defense or other manufacturing fields) have their R&D wing dedicated towards innovation and for somebody interested in making social impact of their zeal for research, this is a great place to be in.
PhD Career in Science Journalism
While pursuing PhD, you are trained to develop your reading and writing skills. You improve on your ability to comprehend written material as well as create your own written documents.
These are skills that come handy if you want to chart a career in science journalism or science communication.
Scientific research is aimed to improve living standards of the society, but it is more often than not, difficult to get across the implications of research to the general public.
Scientific experiments, their findings and their applications are mostly too complicated for a naïve audience. If you are a researcher who can translate this ‘language’ of science to simpler terms for a non-expert audience, then you might find your satisfaction in this career path.
After all, communicating research is as important as doing it. Such candidates may also fit into the shoes of journal editors in scientific publishing houses.
Another job wherein writing skills are required is in medical writing. Scientific writers in this sector are expected to understand regulatory guidelines in healthcare and offer editing and writing services to healthcare professionals in preparation of documents for patients, clients and regulatory authorities.
In recent times, some PhD graduates are opting to take up the role of a science illustrator wherein they help communicate research findings graphically by preparing visuals.
Such creative people also design teaching tools to methodically convey science by means of visual illustrations which is a proven way to grab attention of a curious audience, especially the younger generation.
PhD Career in Industry
In industry, many roles gain advantage by hiring PhD graduates. For instance, positions such as product manager, market research analyst, business development manager or competitive intelligence analyst requires thorough understanding of the present scenario of a particular product, its demand in the current society, its comparison with similar existing products and ways to improvise the product.
These are traits which a PhD graduate develops during the time spent as a researcher. Capability to analyze, carry out comparative analyses and come up with innovative solutions are something that a PhD might help with.
Apart from the roles stated above, this skillset is a must-have for anyone aiming to take up consultancy jobs either in firms or in government policy-making bodies.
Changes that can be implemented to attain scientific advancement in a particular field can be suggested based on knowledge of technical know-how as well as existing literature.
PhD graduates being well-versed with these are excellent candidates for these jobs. In fact, we come across people from varied fields of PhD experience in these professions.
The reason is that a PhD degree is important not just for the field in which it was earned but also for the skillset it brings along. This is to say, that no matter whether you have a PhD in Biology, Chemistry, Mathematics, or an Engineering stream, you are trained to work long hours, be multitasking, analyze complex situations, solve difficult problems, and troubleshoot using different approaches.
Therefore, job vacancies which look for these qualities in a candidate might hire PhD holders from any field.
If you have a PhD in streams like Mathematics, Statistics, Engineering, Physics, or Computer Science, you might be eligible for the position of an analyst, such as quantitative analyst or operations research analyst.
Data analysis, statistical modelling, pattern recognition, and data mining are a few skills required in these career options. Candidates with this background fit well into banking, trading and investment sectors.
With the advent of technology, its utility is being realized in various sectors and thus newer professions are being created to meet the current demand.
Examples of these include healthcare information technology specialist and medical science liaison. A strong background of medical research is required in these jobs.
While the former includes clinical database management and medical coding, the latter requires excellent communication skills and confident knowledge in therapeutic areas.
PhD Career in Entrepreneurship
If you are a PhD graduate who would like to apply your knowledge and creativity to propose an original idea and utilize it to market a product or service as a business option, then entrepreneurship is the way to go.
In recent times, many institutes and companies support start- ups where PhD graduates utilize their experience to initiate something novel and innovative.
After all, novelty in research is what PhD teaches you to achieve and being able to apply this attribute for the society is something to look forward to in case you are motivated and determined enough to steer your own ship.
Tons of PhD Career Out There
When it is time to choose a career path, we often marvel at the vast number of opportunities available and then wonder where we fit best. If you have a long term goal you want to achieve, say a role where you see yourself in future, then you are all set.
Once you finish your PhD, you apply in related job vacancies and take it forward from there. One consideration in this case is whether you need a post-PhD experience.
It is important to remember that not all jobs require a post-doctoral experience, instead you could apply directly after PhD. Some others consider it an advantage and offer you better chances at negotiating your salary and job profile.
If on the other hand, you haven’t yet finalized your career path, but have your PhD degree, then you might want to consider the various options available.
Newer avenues are always on the way, so the list here might not be exhaustive at the time you start your job search. It is essential that you stay updated with job roles of the current time.
The key is to understand where your interest lies. A job is something we rely on for money of course, but it is also something that we spend our day with, and therefore, it needs to be something you are passionate about and enjoy doing.
It is not just about flaunting your Dr. title, it is how you justify your PhD degree. You have spent many long years in the process of earning the title, so you better put it to good use both for yourself and for the society.
In fact, many PhD graduates nowadays participate in social works voluntarily, apart from their regular paying jobs. These can include wildlife, water, or forest conservation, teaching in rural areas, helping with small rural development projects with know-hows, and such others.
All you need to keep in mind is that the world is always on the look-out for talented, enthusiastic individuals, and a PhD degree is most often an advantage (unless you want to sign up for jobs where you are considered over-qualified).
You simply need to have an eye for the career options available and a judgement or self-analysis of your capabilities and preferences. To reiterate, PhD is a wholesome package of technical and transferable skills.
In evaluating your career options, you need to take into consideration both these sets and be decisive of how you can best apply the entire armamentarium of talent that you possess.
Share
Similar Post:
-
How to Start PhD Even if You...
Continue ReadingHow to Start PhD Even if You Don’t Know Anything?
All you need to know for starting a PhD is that you’re inclined towards research. Barring that, you can enter PhD as a beginner willing to learn.
Somebody once told me that it is easier to learn than unlearn and relearn. So, it’s better in some way that you consider yourself a student rather than a person who knows everything.
How to Start PhD? Ist Step
Based on which stream you want to dedicate your time to, you choose your university, your supervisor and research group. This choice is of utmost importance because it decides the course of your academic career from then on.
You should choose a subject area that appeals to you and which you would like to unravel. As for the supervisor, you should read up on the scientific works of the person, see if the research done resonates with your interests. And definitely have a conversation to see whether you’re comfortable with the association.
It’s also important to familiarize with people from the research group, both present and past members. A friendly chat might tell you a lot about the lab and its work culture.
This exercise will help you decide whether you fit well into the group. After all, the lab you choose will be reflected in your career graph and the people you meet in this journey will remain your peers.
How to Start PhD? IInd Step
Once you’ve decided the lab you want to work in, the next important decision is with respect to PhD project. Often, the supervisor decides this for you based on say, a recently-awarded grant or an ongoing project that requires a pair of hands, or a completed project which has given rise to new research questions.
Sometimes however, the supervisor might ask you to propose a project. One way to approach this is to go through the research that the lab has been doing over the years and talk to lab members about ongoing projects.
If you find anything particularly interesting, you might want to follow up on any of these. Else, you may also propose a new idea based on the technical expertise of the lab and the resources available.
How to Start PhD? 3rd Step
Once you select a project, it’s imperative that you read up on the scientific literature available on that. A liking for reading scientific articles (and reading in general) is something you need to develop, if you do not already have it.
It’s perhaps the most important starting point for a PhD. It is crucial you know the findings in the topic of interest, and the chronology of discovery in the field. That would include the history of scientific innovations in the field and recent articles reporting updates on ongoing research.
Having a sound knowledge about these will enable you to frame your research question. This might be based on a loophole that you identify in the current literature or an improvement you envisage.
A thorough knowledge about the field will help you stay away from reinventing the wheel by working on something that has already been reported and will let you undertake your research on a currently trending question.
If it so helps, you could start by going through reviews on your topic of interest and then start reading cited articles. You will be able to refer to relevant articles as you come across them during your reading.
In due course of time, you should evolve your style of reading, for instance, check if you can look at data figures and comprehend the results without going through the text. You could also practice writing data- interpretation and tallying them with published explanations.
Embarking the PhD Journey
PhD being the highest academic degree, it’s often selected as career path by students who fare well in their graduation and post-graduation. So, if you are embarking on a PhD journey, chances are that you have had an aptitude for academics throughout and that you know your broad subject area well.
This is definitely advantageous, but it should remain a positive support during PhD and not become a hurdle in your learning.
Meaning that you should not be over-confident of your academic results till date because you need to realize that PhD is nowhere close to the pattern of study you’re used to: giving examinations and passing them to earn a degree.
PhD requires a different kind of rigor and willingness to learn and apply knowledge. There are no set rules or syllabus to work with. Neither is there a timetable for classes.
You need to be your own teacher, and guardian. You are the one to plan daily work and ensure it gets accomplished. Self-discipline is critical for starting and sustaining PhD.
A Good Working Style is a Great Start for PhD
As they say, a good beginning is half the battle won. You need to be organized, and more importantly, focused during PhD. No matter how you divide time between work and personal life, you should not lose focus of your PhD target.
Both short-term and long-term. Short-term goals are your daily experiments, and long-term target is the far-sightedness of the experiments required to be done for the completion of your project.
A good working style is a great start for PhD and a good habit during the course. Good working practices include taking down notes while you work, and while you listen to presentations.
You should aim to imbibe something from every experience. For instance, if you appreciate a speaker in a seminar, ask yourself why you liked the talk.
Why was the presentation so engaging?
Likewise, if you failed to concentrate in a talk, ask what caused you to lose attention.
Was it because of how the talk was delivered?
Or was it because you need to improve on your listening skills?
Asking yourself these questions will let you understand the do’s and don’ts of presentation-making. It benefits if you attend not just seminars from your genre of work, but also any scientific talk.
If you can listen attentively and understand talks on unknown topics, then it is a fantastic skill that builds your sense of logic and reasoning.
Networking is a Great Skill that Comes Handy During PhD
A good way to start working on a project is to follow up your literature survey with working on bench, trying to reproduce some good old data.
You could choose any piece of data that has been shown to be reproducible in multiple articles and something that is a gold standard for a set of experiments, this could be an oft-used positive control.
To be able to repeat the experiment, you’ll need to learn the technique and perform it. Being able to reproduce the data will give you the much-needed confidence required by a beginner who knew nothing.
Moving on, you should try to master as many techniques as you might anticipate using during your PhD, or whatever techniques you get an opportunity to learn.
Networking is a great skill that comes handy during PhD. You might want to befriend peers from neighboring labs, and technicians managing departmental instruments.
Such association will enable you to learn new techniques, often beyond the scopes of your own lab. Your learning need not and should not stay limited to hands-on bench experiments but should also include learning software and data analysis tools.
When you have a deadline for analyzing a huge set of data, that should not be the time you start learning from scratch. Instead, it helps if you are open to embrace new technology and utilize your time learning new things.
.... utilize the long PhD time fruitfully ...
While you learn and practice, give yourself the freedom to make mistakes. Do not put unwarranted burden on yourself to excel the first time you try anything.
PhD is usually a long duration of time, and students often refrain from exploring new territories in fear of wasting precious time.
On the contrary, the approach should be to utilize the long PhD time fruitfully. Accept that learning something new might take time and have the patience to give yourself the time.
Learn from the mistakes you make, take notes of where you went wrong, and reflect upon how you could better it. You need not always work for publishable quality data; you need to instead work towards reliable and reproducible data.
If that requires you to take time off from bench and think about experiments, possible improvements, ways of redeeming etc., then you should go ahead and give yourself the much-needed break form bench-work.
It is essential to be both methodical as well as adventurous during your PhD. You could work according to your set schedule, and function to achieve perfection. But that might not always happen.
In case of failure to comply with your planned experiment for whatever reason, you should not lose zeal; instead, you should try to be creative to solve the problem and be prepared to take on risks and unplanned measures. Students often prefer to have alternate project ideas in case the current project fails to turn out as hypothesized.
Knowing nothing is expected to awaken the learner in you. That coupled with a positive attitude to learn and apply knowledge is what makes a great start for PhD.
Share
Similar Post:
-
Online PhD Programs: Pros/Cons
Continue ReadingOnline PhD Programs
Earning a PhD degree is prestigious and is a result of hard work over several years. While traditionally, you needed to work in a university / institute while pursuing the degree, in recent times, opportunities are being offered for students to pursue the degree online.
This means that you could work towards the fulfillment of the degree from the comforts of your home. While this flexibility might seem lucrative for some of you, some others might find it a little daunting.
Well, the fact is that online PhD programs have both pros and cons, and it is best to consider both sides of the coin before you embark on the journey.
Benefits of Online PhD Programs
There are numerous benefits of online PhD, some of which are discussed here:
i. Opportunity to Multitask
Being able to pursue PhD online enables you to simultaneously have a regular paying job on your platter. You might also want to later use your PhD degree to upgrade your current job profile.
In fact, several companies allow their employees to take a break for doing a PhD so that they can come back with greater efficiency at their duties.
Also, having a guaranteed job while working towards an academic degree, is a great assurance both financially and with respect to future career security.
If for any untoward reason, you fail to cope up with the degree requirements, you still have a fallback option to look forward to.
ii. Online PhD Programs are Cost-effective
Course fees for PhD can be difficult to arrange for some people, which is a common reason why people opt for online PhD, while arranging to pay for it by working somewhere else.
Having said that, online PhD programs which are not fully funded often have tuition fees on the lower range as compared to traditional PhD programs.
Additionally, students save up on travel and accommodation costs, as they can pursue the course from home.
iii. Online PhD Programs are Flexibile
Traditional PhD programs have set rules with respect to course timings, deadlines for completing assignments, meetings with supervisor and often require commitment to teach undergraduate students.
Most of these being absent in online PhD, it gives you the flexibility you might yearn for while carrying out research. At a point in life when you pretty much know how to organize your daily schedule, how and when you work best, it is a great opportunity to be able to plan your daily life while doing a PhD at your own ease and comfort.
iv. Long-term Soft Skill Development
In a traditional PhD, you might want to run to your supervisor or a dear colleague as and when you get stuck with a problem. In online PhD, you do not always have this luxury. And this limitation, in the long run, can prove beneficial to shape you up as a researcher.
You learn to troubleshoot your problems with little or no assistance from others. You get trained to face challenges, be independent and develop a sense of self-discipline.
v. Accessibility
One of the biggest advantages of online PhD is that you are not limited by your geographical location. As you are not required to relocate, you can choose your university/ mentor of your choice without worrying about whether you will be able to move to their location.
All you must worry about is steady internet access and a work/study environment of your choice.
Drawbacks of Online PhD Programs
While these are certainly some positive aspects of online PhD, it does have some cons to consider:
i. Online PhD Programs are Long Duration
It is no new information that completing a PhD is a lengthy process. Students in traditional PhD programs often find it difficult to finish the requirements of the degree within a stipulated period.
Those opting for online PhD additionally have a regular job (most often) to devote their time to. Also, since there are no strict timings, this flexibility might come in the way of completing work on time. This in turn delays the entire process.
ii. Lack of Interaction with Mentor and Colleagues
An invaluable experience during PhD is that of one-to-one interaction with a supervisor. The discussions with your mentor, as well as the round-table meetings with your labmates are something you will miss out on if you pursue PhD online.
This is not to say that you are completely isolated; you definitely have online discussion forums and email access to your supervisor, but that is an experience different from face-to-face conversations.
iii. Diminished Long-term Value of the PhD Degree
This is a sad truth that not all online PhD degrees are considered ‘job-worthy’ later in life. Employers often prefer candidates with a traditional PhD over those with an online PhD.
So, the degree is not recognized everywhere, thus diminishing your job prospects. This problem can in part be overcome by registering with an accredited course / university.
One complaint of employers is that working from home (during PhD) does not automatically guarantee a candidate’s ability to work on-site, which is why many accredited universities now offer certain on-campus experience for people pursuing online PhD.
Online PhD programs: Do You Want to Study While Working?
Like many other things in life, the decision whether to do online PhD Programs or not depends on what you are aiming for and what your circumstances are.
Do you want to study while working?
If so, online PhD is a great option. But then, not all streams offer online PhD. For obvious reasons, PhD in Biology, Chemistry, Medicine and such other subjects are not feasible to be done online, because you require exposure to laboratory routines.
Other disciplines such as Business, Psychology, Artificial Intelligence, Data Sciences etc. might be conducive for an online PhD format. So, depending on your area of choice, you can opt for online or traditional PhD Programs.
The choice also depends on how you work best. Some people love working amidst colleagues and friends, in a university setting. Restricting them to their homes might end up making them feel claustrophobic, lonely and helpless. Needless to say, mental health is a critical determinant of PhD.
In the stressful life that PhD is, it is extremely important to be able to work in a favorable setting to achieve maximum efficiency. We also have people who prefer to work in quiet surroundings, in their homes where they are not distracted by others.
They are able to concentrate and hence work better in such settings. People such as these are ideal candidates for online PhD. Also, as stated earlier, doing PhD online requires meticulous handling of one’s daily life, responsible time management skills and self-discipline.
If you are committed to monitor yourself and keep yourself motivated without constant supervision, then online PhD might work for you. Such programs require self- confidence with decreased reliance on others for problem-solving.
To reiterate, it is important to choose the university for online PhD judiciously. Doing it from a non-accredited place can end up wasting a lot of time on your part with the final result not at par with what you would have expected.
It is to be remembered that earning a PhD is difficult and demands a lot of dedication and time, so doing it the best possible way is a plus. As they say, a good beginning is half the battle won.
And the beginning of a PhD is to decide how you want to pursue it: traditional or online. One needs to decide with a conscious mind, judging based on both the pros and the cons.
Share
Similar Post:
-
Why Pursuing PhD is a Nightmare?
Continue ReadingWhy Pursuing PhD is a Nightmare?
As we grow up, we fantasize about a lot of things, career being one of them. A lucrative steppingstone in the competitive world is a PhD degree, which is why it is a cherished dream for many.
It is also a dream for those who are so passionate about research that they take this leap of PhD without planning what they want to do thereafter.
No matter what drives you into doing a PhD, there is a chance (and unfortunately not a negligible one) that it might turn a nightmare. Hoping that you never face this, let’s discuss why this might happen and how to safeguard against it.
Do I need a PhD?
First and foremost, ask yourself: do I need a PhD? If you have a career plan, consider whether PhD adds value to it. If not, please do not pursue the degree simply for an attraction for the Dr. title.
Not every profession requires a PhD or has better salary or job profile for PhD-holders. On the other hand, if you do not yet have a career goal, you need to ask yourself:
Am I committed enough for PhD?
Can I withstand long years without a guaranteed/permanent job?
Do I have the luxury to survive on a scholarship?
The reason you should ask yourself these questions is because in the absence of a post-PhD plan, only motivation can keep you going. One needs to stay focused and have unfailing mental strength to pay a deaf ear to inner voices asking you to quit PhD.
However bizarre this might sound, this does happen to many PhD students. Being attracted to research is a fantastic feeling to start your PhD with, but you should also not be unaware of the realities of PhD life.
Be warned that there are hardships and disappointments on the way. Are you armed to face these? If yes, then it is a wonderful world waiting for you. If not, you might be signing up for a nightmare.
Am I Committed Enough for PhD?
When I say ‘armed’, what do I exactly mean? A lot of things contribute to preparing you for failures during PhD. The first thing you need to know once you decide on doing a PhD, is where you want to do it and under whose supervision.
The choice of university and research lab is crucial, not just during PhD, but for everything thereafter. Your choice is going to be reflected in your resume forever. And the expertise that you gain will accompany you for the rest of your life. So, choose judiciously.
Do not get carried away by flamboyant advertisements, instead do your homework right. Get to know on how the laboratory is, how the supervisor is, how people in the lab are. Remember you are going to be working with them for the next 4-6 years and are going to be associated with them for much longer.
Does the work of the lab resonate with your research aptitude?
Do you find yourself a good fit with the lab schedule?
Do you feel comfortable talking to the mentor?
Even the location of the lab might be important. If you are signing up for a traditional PhD (as opposed to an online format), you might want to dwell upon whether it is fine for you to relocate.
PhD: a Sheer Length
As most of us know, the duration of a PhD is long. It might take a good 4-6 years on an average to get a degree. Some might think, this is a frustratingly long time. Some others might think, well this is a long time, I have enough time to relax. Both these views can be damaging for a PhD graduate.
If you get demotivated by the sheer length of PhD, you might lose interest or zeal to try new things. You might think, why don’t I stick to traditional methods and get my job done faster.
I don’t have time to try or learn new techniques. Innovation is lost if you think in this manner.
Conversely, if you are of the opinion that 5 years is a lot of time, let me take it easy, you might lose track of time. Trust me, no time is enough for finishing a PhD, because there is just so much to do. You definitely do not have to work 24×7, but you do need to stay focused.
You need to realize that last-minute hurriedness cannot fetch you a PhD. It is not an exam where you can stay up all night, prepare and sit for it the next day. In PhD, you need to accumulate data over a period.
Experiments cannot be done overnight. It is true that you have lots of liberty during PhD. You no longer have exams or assignments; you do not have somebody asking you to submit your homework.
Apart from reporting to your supervisor on a regular basis, you are pretty much on your own, you have the freedom to plan your day as you like. But freedom if misused can cost dearly.
So, a critical requirement to avoid a nightmarish PhD is to prioritize. It is essential to have the bigger picture in mind:
Where are you headed with your project?
What are you short-term and long-term goals / experiments?
.... losing precious time of your PhD ....
When we start our PhD, most of us are so excited to gain hands-on experience that we often forget to survey the literature.
Is my research topic relevant to the field and to the current time?
Has this research been done previously?
Is anybody else working along similar lines?
These might sound stupid questions, but to err is human. It is heart-breaking if you uncover after years of hard work, that what you found was already discovered / invented.
Your research might not be worthy of being published and you end up losing precious time of your PhD. When we come up with a hypothesis, it is very dear to us, and working to prove it right only make us love it more dearly.
However, if it does not hold true after testing by all possible means, then it is worthwhile to abandon it. PhD does not go on forever and one needs to decide with an open mind. Along similar lines, PhD students often face the dilemma whether to quit their lab and supervisor if things turn sour.
This situation is undoubtedly depressing, but it is better to move on rather than wasting time over something that does not work in your favor. As a matter of fact, many PhD students have flourished extremely well after they set out to do something different than what they started on.
The important thing is to know when to move on. Mindful graduate students even prefer to have an alternate project-idea as a fallback option.
Can We Avoid a Nightmarish PhD?
A nightmarish PhD can also be avoided by adapting good working practices. A PhD student should not only be working hard but working carefully, meaning for instance, that it is important to back up your data and speak with caution of your unpublished findings!
Likewise, it is important to order your reagents well in advance so that you are not waiting for them when you need to set up a crucial experiment. An important piece of advice I once received was to conceptualize an experiment on paper before performing it.
That way, you would think about positive and negative controls required for your experiment and are well prepared with troubleshooting ways for things that can possibly go wrong. It is an advantage if you have thought of what to do next if your current experiment fails or if it works as hypothesized.
You save a lot of time in PhD if you plan well. It is crucial to strategize and work with a manuscript in mind, giving yourself enough time to address reviewers’ comments should any come up when you are ready to publish your research.
Writing can appear a daunting task; so it is good to develop a habit of taking down notes while you work and keep preparing introduction and methodology sections for your paper/thesis along the way.
Having a healthy personal life contributes immensely to an enjoyable PhD. It helps if you network with your peers and friends not just from your lab, but also from neighboring labs.
Emotional support is a great help at times when you feel low. Unkind words of people might hurt you as badly as an experimental failure. It is therefore vital that you do not let yourself be pulled down by either of these.
There is something to learn from both good and bad times; utilize them to increase your potential. Make the most of your PhD time, not just by honing your technical skills but also by developing transferable skills.
What job you land on after PhD depends on both these skillsets. Indulging in an extracurricular activity and listening to motivational speakers are fabulous ways to stay positive during PhD.
In a nutshell, having work-life balance while working with focused attention are all it takes to avoid a nightmarish PhD.
Share
Similar Post:
-
What is PhD Dissertation? Introduction and Structure
Continue ReadingWhat is PhD dissertation?
PhD dissertation or doctoral thesis is a documented account of your findings for partial fulfilment of PhD degree. Once you’re confident to present your work, you prepare a write-up comprising of what motivated you to start the project, how you proceeded to investigate a problem, what your findings are and how you interpret them.
PhD Dissertation is evaluated by examiners, assigned from both within the host university as well as externally, often internationally. The selected examiners are experts in your area of study who provide you with insightful analysis of your data and help you with critical suggestions for improvement.
You’re expected to incorporate these inputs and make a final submission, which is then considered for awarding you the much-awaited PhD degree. The contents, length and format of a PhD dissertation vary according to institute requirements as well as by personal preference.
Component of PhD Dissertation
Broadly however, PhD Dissertation comprises of:
i. Thesis Cover
This is meant to provide all important information at a glance. It includes the thesis title, your name, the name (and logo) of your institute, and the year of submission. Many students include their supervisor’s name. Some people prefer to include an artistic depiction of their results or a scientific image, say, from a microscope, or a field camera.
ii. Declaration
Some universities want you to include a signed self-declaration, stating among other things, that the thesis findings are original work and have not been used for the conferral of any other degree at any other institute.
iii. Synopsis
This is a summary of your entire work, beginning with a short paragraph on the background, the broad question, followed by a brief description of the methods and results of the investigation, and ending with a note on the relevance of your findings.
iv. Introduction
Before embarking on research, a student usually surveys available literature for work done till date on the topic of interest.
What are the findings of previous researchers?
What are the loopholes in available data?
What improvements are possible?
To answer these, it’s important to read as many scientific articles as possible to know the state of affairs. Each published article addresses a scientific problem to a small extent. Putting these findings together helps to comprehend the chronology of development in the field and enables us to connect the dots to form a bigger picture.
The introductory chapter is where you introduce the major players of your story, the known facts and literature references required for you to get started. Each statement here should cite original works, which are expanded later in the References section.
v. Materials and Methods
This section describes your tools, the materials used, and techniques employed to carry out the investigation. You should acknowledge the manufacturer of reagents and give appropriate usage instructions.
Often reagents are gifted by peers and a kind acknowledgement is warranted when you cite them. It’s said that standardizing assays takes longer than generating presentable data.
It’s worthy therefore to pen down every necessary information, in such detail that a new researcher finds it easy to reproduce your results and take the project forward.
It’s a nice gesture to help a successor, so that time is not wasted in reinventing the wheel. In fact, you might want to revisit your dissertation later to learn techniques that you once performed with great efficiency but have lost touch with!
For this exercise to be effective, you need to be methodical throughout your PhD, and take down notes while doing experiments. If you believe you’ll be able to recall everything from memory, then you might be in for a shock!
While writing your dissertation, you’re most often restricted by a deadline, and it might be difficult to recollect experimental nitty-gritties. In fact, it’s a good practice to start organizing the sections on literature survey and methodologies well in advance while you’re still working. That saves a lot of time and effort later.
vi. Results
This is where you report the findings of your experiments. This section is essentially a combination of text and data figures. You describe the rationale of undertaking an experiment, what your hypothesis was, and what you expected to address with the experiment.
You then report the observation and analyze it. Each experiment is described in detail and connected with the prior experiment and the subsequent one, thus building up to a story.
An experiment thus leads you to another question which you try and answer in the next one, finally culminating in an interpretation of the combined results.
vii. Discussion
It’s great to be confident of your research findings and it’s equally essential to be open to analyze your results in the light of current knowledge. Your data might support some views in the field while it might contradict certain others.
It’s crucial to respect peers and give due credit to their findings, whether or not your findings align with theirs. What is critical is to place your research in a broad perspective:
How do your results support previous data?
Are you able to reproduce some crucial data from previous publications?
Why do you think your findings are different than certain others?
What are the scopes of improvement in your research?
Questions such as these are answered here. You may also utilize this section to discuss data which might not fit into your initial hypothesis but which you have worked upon to give your research a new direction.
This is really a fantastic place to reflect upon your data and freely express your thoughts about it.
viii. Contribution to the Field
As an extension of the previous section, some people describe the implications of the current research, how the findings help the field progress and how they contribute to solve unanswered puzzles.
ix. Future Directions
A PhD dissertation is an incremental contribution of a single person to a huge field of study. It’s never expected to culminate discovery. You’ve done your best in the given time frame, and no time limit is ever enough for the progress of science.
Research is an ongoing process, and although you might have earned your PhD degree, your thesis will have a section on future directions. It’s vital you understand where your research is headed, what advances could be done and what are the missing links.
Students often misinterpret this section as a list of unaccomplished tasks and therefore consider it a drawback. On the contrary, a well-written section on the future possibilities demonstrates your ability to think beyond your degree, it shows that you’re interested to see your project move beyond the scopes of your dissertation and provides valuable research ideas for your successors.
Be rest assured that you’ll be gratefully acknowledged for the same! Having worked on a project for many years, it’s imperative that you’re the most knowledgeable person about your project and are the best one to suggest research projects branching out from it.
x. References
Previously published literature from peer-reviewed journals or theses cited in the text should be described in internationally accepted formats (like APA, MLA, etc.) in this section. A good PhD dissertation should cover major and minor contributions in the field, so that a reader can find necessary literature to refer to if desired.
A Perfect PhD Dissertation!
The sections described above are the commonly used ones in dissertations worldwide. There might be minor alterations and inclusions though.
Students often incorporate Acknowledgements (to thank the many people who helped them, including supervisor, family, friends, and others), List of Abbreviations (for quick access to expansion of acronyms), and List of publications (to mention the articles which cover findings from the dissertation).
As you might understand, PhD dissertation is a record book of everything you’ve done to achieve that special degree. So, it’s best to give due prominence to it.
You’ll realize that this remains extremely dear to you, although later in life you might want to rectify the writing abilities of your younger self!
Nevertheless, given the time constraints that you must complete writing your thesis in, it’s best to plan and manage your time accordingly. Not every university gives you dedicated time to write your thesis, instead you are expected to carry on working while you write.
It usually helps if you’re organized throughout your PhD and do not have to dig in and fish out every information with great difficulty form your lab notebooks! Although a PhD dissertation doesn’t usually have a word limit, it’s good to keep the language clear and concise, with minimal re-iterations.
You wouldn’t want your examiners to get bored of reading! The onus is on you to write your dissertation in a way that is enjoyable to read and easy to understand, such that it does not challenge the attention span of your readers.
It should reflect how articulate you are in conveying your research on paper. It’s worthwhile to categorize your dissertation into well-defined chapters, and needless to say, please do avoid typographical and grammatical errors, and plagiarism.
Even self-plagiarism is discouraged in several universities, meaning that you’re expected to re-word yourself even though your thesis and published paper might cover the same results.
Some universities however allow students to compile all their papers and present them as their dissertation.
Overall, PhD dissertation is a testament to the hard work of a student who by the completion of PhD, is an expert in the dissertation topic.
PhD Dissertation Citations
Share
Similar Post:
-
Facilitated Diffusion: Definition, Types, and Examples
Continue ReadingFacilitated Diffusion Definition
Facilitated diffusion (also known as facilitated transport or passive-mediated transport) is the process of spontaneous passive transport (as opposed to active transport) of molecules or ions across a biological membrane via specific transmembrane integral proteins.
What is Facilitated Diffusion?
Facilitated Diffusion is a passive transport where the movement of molecules is mediated through the plasma membrane with the help of transporter protein such as carrier is called as facilitated diffusion.
The transfer of molecules takes place from a higher concentration area to a lower concentration in facilitated diffusion as well, like simple diffusion. The solute concentration variation through the membrane is the driving force responsible for facilitated diffusion.
Although majority of facilitated diffusion does not suffice the need of ATP, however in few cases it does require ATP. Facilitated diffusion take place due to the exactitude between the carriers and the solute.
In facilitated diffusion molecules can progress in both the direction i.e., towards or against the concentration gradient. Kinetic energy along with concentration gradient helps to carry out facilitated diffusion.
The molecules which can pass through are water soluble huge molecules through the plasma membrane in facilitated diffusion.
Facilitated Diffusion Principle
Plasma membrane’s lipid bilayer is hydrophobic, thus water-soluble molecules cannot pass through; however tiny water molecules due to their concentration gradient can pass through the membrane. Although hydrophobic huge molecule requires either carriers or channel protein to pass through the membrane.
When molecules passes with the help of the channel protein, there are pores present in the transmembrane of the membrane, resulting in the flow of molecules and are spread throughout the cytosol and outer surrounding thus, extending to the other organelles.
Through the transmembrane channel, charged molecules will move and these transporters protein are incorporated to the membrane, having attraction towards the matrix.
However, in other cases, molecule will attach to the carrier protein, which will change the shape of the molecule leading to the molecule move inside the cytosol, and this process is seen in enzymes, which are huge molecules.
Facilitated Diffusion and Channel Proteins
These proteins aid in the movement of molecules, by channel formation through the membrane and in this membrane lies the transmembrane proteins which are ions.
These channels have a diameter of 4-5 Armstrong and can be choosy and allow only a particular ion to move through such as positive ion and will have differences for various ions, thus being picky towards a particular ion. In the extra and intracellular matrix, hydrophilic domains and core are possessed by these channel, thus cracking the layers wide open.
The water movement through the membrane is mediated by the aquaporins at a very faster pace. On the receival of the electrical signal or attachment of molecule, the doors gets closed and open.
Facilitated Diffusion and Carrier Proteins
Carrier proteins perform facilitated diffusion, by transporting the molecules through the membrane. They do so by attaching to the molecule and getting changes in its shape as they are heavy and then it can move within the cell on the basis of the concentration.
The change in shape also has an impact on the hydrogen bonds. Carrier protein are quite specific in terms of their binding sites, such as they recognize between the D and L sugar type, which makes the plasma membrane as well specific.
Saturation occurs when carrier protein attaches to the substrate, thus allowing movement to take place at a faster pace. They play role in active transport which requires energy for the transportation of molecule.
Factors Affecting Facilitated Diffusion
Environmental factors are the one which has an impact on facilitated diffusion:
a) Concentration Gradient: The diffusion through the membrane occurs due to concentration gradient, which happens from a high concentrated region to a lower concentrated one. However quick diffusion happens due to the concentration diffusion.
b) Temperature: For the shape to change, the amount of energy required is quite high than the activation energy. As the temperature increases the carrier transportation also increases, thus elevating the reaction rate between the carrier protein and the substrate in the molecule.
c) Saturation: On the membrane, carrier proteins are present in specific amount and once these sites are occupied, no more proteins can bind. Thus, even if concentration gradient rate is elevated, rate of diffusion cannot be elevated.
d) Selectivity: Selectivity and transportation rate are reciprocal to each other, as selectivity is achieved from the binding sites which do not treat all the solutes equally, thus ceasing the movement.
Facilitated Diffusion Examples
1) Glucose and amino acid transport: Example is the movement of glucose and amino acid from blood to the cell is the facilitated diffusion example. Through active transport they reach the intestine and are left into the blood. These molecules are moved to cell from the blood through carriers such as amino acid permease and glucose transporters, as they are quite huge.
2) Gas transport: A different example is when to the muscle and the blood, oxygen is transported. The carrier protein is hemoglobin blood and myoglobin in muscle, which results in diffusion due to increase in pressure and thus gets moved to the other side with low pressure. The same process is involved in carbon monoxide and dioxide.
3) Ion transport: Ions possess the same charge like the membrane and are polar thus, cannot move through and thus have transmembrane protein also known as ion channel which are choosy for ions like Na, K and Ca and the transport has to be quick as no energy is used.
Biological Importance of Facilitated Diffusion
The homeostasis between the outer and inner environment is regulated by facilitated diffusion. It also makes the biological membranes specific. Various functions are regulated by facilitated diffusion such as ion transport, oxygen transport and transportation of sugar molecules.
Facilitated Diffusion Citations
- Facilitated diffusion in chromatin lattices: mechanistic diversity and regulatory potential. Mol Microbiol . 2005 Aug;57(4):889-99.
- Facilitated Diffusion Mechanisms in DNA Base Excision Repair and Transcriptional Activation. Chem Rev . 2018 Dec 12;118(23):11298-11323.
- Facilitated diffusion of Argonaute-mediated target search. RNA Biol . 2019 Sep;16(9):1093-1107.
Share
Similar Post:
-
Frameshift Mutations: Definition, Mechanism, and Examples
Continue ReadingFrameshift Mutation Definition
Frameshift mutations occur when nucleotides in the coding region are inserted or deleted, resulting in an altered amino acid sequence during codon translation. A phenotypic alteration, such as the synthesis of an altered protein, may occur from this sort of mutation.
What is Frameshift Mutation?
Frameshift mutation is a form of gene mutation in which the addition or deletion of one or more nucleotides produces a shift in the reading frame of the codons in the mRNA, which can result in an amino acid sequence change during protein translation.
Frame shift mutation is a variant. Reading frame mutation, reading frame shift or framing mistakes are all synonyms for frameshift mutation.
Causes of Frameshift Mutation
The nucleotides of a nucleic acid (such as DNA) can be “read” in groups of non-overlapping, consecutive triplets known as a reading frame. Triplets (or codons) in a reading frame are translated into particular amino acids during translation (or a codon signal).
As a result, if a mutation occurs, such as an insertion or deletion of a nucleotide, the reading frame may be altered. The amino acid sequence is entirely altered. Such changes are known as frameshift mutations (also called reading frame mutation, reading frame shift, or framing error).
The deletion of two nucleotides, which in the above diagram are the nucleotides containing bases, cytosine (C) and guanine (G), has resulted in an erroneous amino acid (G). Glutamate has taken the role of arginine (arg) (glu).
The reading frame is unaffected by the insertion or deletion of nucleotides in multiples of three. As a result, the protein in these situations is likely to have an additional or missing amino acid.
Frameshift mutations are most commonly generated by a mutational mistake during DNA replication or repair. Exposure to acridine dyes, which are capable of causing frameshift mutations, can also cause them. The reading frame of the nucleotide sequence changes due to insertion or deletion (also known as indels) of the nucleotide.
However, the consequences of these mutations vary depending on where they occur. At the interstitial or intercalary location, a nucleotide can be added or deleted.
In certain cases, the insertion and deletion of nucleotides happen at the same time (known as double frameshift), restoring the reading frame to its original state.
A frameshift mutation can cause the whole structure and function of a protein to be lost, resulting in a non-functional polypeptide. However, the phenotypic impact of the mutation will be decided by the resultant codons, post-mutation, and mutation location.
There are three sorts of codons that occur from frameshift mutations;
1. Sense Codons: are codons that are read in the same way they were before frameshift mutation.
2. Missense Codons: these are codons that result in the production of an erroneous or different amino acid.
3. Non-sense Codons: these are codons for which no matching tRNA exists, causing the translation process to be truncated.
As a result, frameshift mutations produce an aberrant or faulty protein product with an incorrect amino acid sequence. Such proteins may be entirely new or unusable, depending on where the mutation occurs. A stop codon can also occur from a frameshift mutation. The premature stop codon on mRNA will interrupt the translation process, resulting in a short polypeptide.
The protein may be shorter or longer than the normal protein, depending on the degree and type of the frameshift mutation. Such mutations might arise naturally or as a result of external stressors.
Frameshift mutations are more common in Adenine-Thymine (AT)-rich areas of the nucleic acid, which is an intriguing finding.
Types of Frameshift Mutations
Frameshift mutations can arise when a nucleotide in the nucleic acid is deleted or inserted. A Deletion frameshift mutation occurs when one or more nucleotides in a nucleic acid are deleted, causing a shift in the nucleic acid’s reading frame, or reading frameshift.
Deletion is a more typical method for causing a frameshift mutation, which causes an altered reading frame. (+) 1 frameshift mutation is another name for this mutation.
Insertion frameshift mutation occurs when one or more nucleotides are added to the nucleic acid’s base sequence, causing a shift in the reading frame. The number of nucleotides and the position of nucleotide insertion determine the severity of this sort of frameshift mutation.
The (-) 1 frameshift mutation is another name for this mutation. Understanding frameshift mutations that arise when a nucleotide is inserted or deleted from the usual nucleotide sequence.
Effects of Frameshift Mutations
Frameshift mutations can lead to the following outcomes:
1. A protein with a changed coding sequence may be unusable or a totally different protein. As a result, a variety of metabolic processes may be disrupted.
2. An abrupt halt to the translation process results in non-usable protein, which has ramifications for the physiological systems involved.
3. A frameshift mutation can also lead to cellular translational process abnormalities. The cellular machinery may correct the mistake by upregulating the expression of the mutant gene if no functional protein is produced owing to frameshift mutation. This can cause the cell’s translation machinery to malfunction. As a result, a high number of misfolded proteins may develop, which might be fatal to a cell.
4. However, as seen in HIV patients with frameshift mutations in the chemokine receptor gene, the altered protein might be advantageous and give protection (CCR5).
5. Frameshift mutations cause Crohn’s illness, cystic fibrosis, and some kinds of cancer.
The Genetic Code
The nucleotides encode all of the genetic information in RNA and DNA. A three-nucleotide sequence contains genetic information. Each nucleotide triplet is eventually translated into particular proteins that are necessary for diverse biological activities. There are two crucial stages in the translation of genetic information into protein.
1. Transcription: The genetic information encoded on DNA is “rewritten” on RNA in this process.
2. Translation: In this case, the transcribed RNA is “translated” into a particular amino acid sequence, which finally forms a polypeptide or protein chain.
Discovery of the Genetic Code
The transmission of genetic characteristics in Gregor Mendel’s early genetic studies suggested that genetic information is passed down from generation to generation as a discrete physical and chemical entity. Amino acids were later considered to be genetic information carriers.
The codons or triplets on the DNA sequence were found by scientists including Francis Crick, Sydney Brenner, Leslie Barnett, and Richard Watts-Tobin. Marshall Nirenberg, Heinrich J. Matthaei, and Har Gobind Khorana (1961-1964) discovered and deciphered the nature of a codon.
Reading Frames and Triplet Codon
The whole genome is split into three three-nucleotide segments that do not overlap. The reading frame is defined by the triplet codon that starts the translation process. A particular amino acid or a stop signal known as a codon is encoded by each triplet of the nucleotide. Twenty amino acids are encoded by 64 codon combinations.
However, three of these 64 codons are stop codons, resulting in 61 codons coding for amino acids and three codons coding for the end of the translation process (i.e., 61 codons for amino acids + 3 stop codons = 64 codons).
The following are some of the characteristics of a codon:
1. Each codon codes for a specific amino acid during translation. The beginning of amino acid synthesis, as well as methionine synthesis, is encoded by the AUG codon.
2. The three “stop” codons are UAG, UGA, and UAA, which signal the end of amino acid synthesis.
3. Codons are a universal language.
4. The translation process begins with a start codon and continues until the stop codon occurs on mRNA.
From the N-terminus (methionine) to the C-terminus, mRNA is encoded from 5′ to 3′, and it translates into an amino acid in a protein.
Ribosome Translocation
Each codon is converted into an amino acid by mRNA. The ribosomes then link these amino acids together in a process known as ribosome translocation. Protein synthesis is a cyclic process in which the ribosome advances three bases after adding one amino acid to the expanding chain of the polypeptide (i.e., one codon). The function of proteins and polypeptides is disproportionately affected by ribosome mobility.
Frameshift Mutation Examples
Let’s look at a base sequence in RNA that codes as follows to better understand frameshift mutations:
AUG-AAT-AAC-GCU = start-leucine-asparagine-alanine
If an A nucleotide is added or inserted after the start codon AUG as a result of a mutation in the aforementioned sequence, This will alter the reading frame fully:
AUG-AAA-TAA-CGC = start-lysine-isoleusine-alanine
As can be seen, adding only one nucleotide to the RNA sequence entirely changed the base sequence, resulting in the production of completely new amino acids during translation.
Other Examples
The coding sequence for a particular polypeptide is read continuously from the start codon AUG to one of the three stop codons in the reading frame of any mRNA.
The ribosome interprets whichever codons follow the start codon as it travels along the mRNA three bases at a time during translation. The usual reading frame can be disrupted by adding or removing one or two bases (or any other number that is not a multiple of three), resulting in the creation of a fully non-functional protein.
A premature stop codon can also be introduced by frame changes.
Original coding sequence: atggtgcatctgactcctgaggagaagtct
Amino acid translation is M V H L T P E K S
Frameshift: atggtgcctgactccTGAggagaagtct
Amino acid translation is M V P D S * G E V X
Frameshift Mutation Diseases
Mutations are a source of diversity; yet, some mutations are harmful and result in illness. Frameshift mutations have been linked to the following diseases:
1. Tay-Sachs Disease: Tay-Sachs disease is caused by a frameshift mutation in the Hex-A gene. In the absence of Hex-A, aberrant lipid build-up in the brain occurs. The lipids build up in the neurons and finally kill them. This is a deadly illness.
2. Cystic Fibrosis: Cystic fibrosis is caused by two frameshift mutations in the CFTR genes (one involves the insertion of two nucleotides and the other involves the deletion of one nucleotide). The CFTR gene controls the correct passage of ions across cell membranes in the lungs and other organs, such as chloride and sodium. In cystic fibrosis, frameshift mutations cause organ dysfunction, recurrent lung infections, and pancreatic damage.
3. Leigh Disease: The NADH dehydrogenase (ubiquinone) Fe-S protein 4 (NDUFS4) gene has a frameshift mutation that makes Leigh illness. Leigh illness. Leigh disease is a mitochondrial mutational illness that manifests as a progressive neurodegenerative condition that begins in childhood. The patient had feeding problems, hypotonia, seizures, central respiratory impairment, and failure to thrive in this case.
4. Type A Niemann-Pick Disease: Type A Niemann-Pick disease has been linked to a frameshift mutation in the acid sphingomyelinase gene (fsP330).
5. Crohn’s Disease: A frameshift mutation in the NOD2 gene causes Crohn’s disease susceptibility. The truncated protein NOD2 is produced by cytosine insertion (3020insC), which has been linked to Crohn’s disease.
6. Specific Diseases: frameshift mutations can cause malignancies including lung cancer, colorectal cancer, and hereditary breast, ovarian, and pancreatic cancer.
7. Hypertrophic Cardiomyopathy: One of the main causes of sudden death in young adults is hypertrophic cardiomyopathy. Hypertrophic cardiomyopathy is a cardiac myocyte genetic disease. A frameshift mutation in Troponin C induces hypertrophic cardiomyopathy (c.363dupG or p.Gln122AlafsX30).
8. Smith–Magenis Syndrome: caused by an interstitial deletion in the retinoic acid-induced 1 (RAI1) gene. This is an uncommon multiple congenital abnormality or mental retardation condition. Mental retardation, craniofacial and skeletal abnormalities, speech and developmental delays, unique behavioural characteristics, and sleep disruption are all common in these people.
9. Hereditary Polyneuropathy: a dominant-negative frameshift mutation in the LRSAM1 gene causes hereditary polyneuropathy.
Effects of Frameshift Mutations
Frameshift mutations can be advantageous, harmful, or fatal. Induction of frameshift mutation, for example, has been utilised to produce bacteria capable of generating nylonase, a degrading enzyme. Some incidences of albinism have been linked to the premature termination of any of the enzymes required for melanin synthesis.
Various mutations, including frameshift mutations, in the HEXA gene, which codes for the alpha subunit of the lysosomal enzyme beta-N-acetylhexosaminidase A, cause Tay Sachs illness.
Point Mutations vs Frameshift Mutations
Let’s compare and contrast point mutation and frameshift mutation to see how they vary. In point mutation, one base in the nucleotide sequence is replaced by another base. As a result, the nucleotide sequence or nucleic acid reading frame stays unaltered.
Point mutation is also known as single base substitution because of this. Point mutations are divided into two categories: transition and transversion.
Purines and pyrimidines make up DNA. When a purine base is substituted for another purine base, transition point mutation occurs, whereas transversion happens when a pyrimidine or vice versa is exchanged for a purine base.
The insertion or deletion of a base in a frameshift mutation leads to a change in the nucleotide’s reading frame in a nucleic acid.
Frameshift Mutation Citations
- Frameshift mutation, microsatellites and mismatch repair. Mutat Res . 1999 Nov;437(3):195-203.
- Frameshift mutation: determinants of specificity. Annu Rev Genet . 1990;24:189-213.
- Frameshift mutation of UVRAG: Switching a tumor suppressor to an oncogene in colorectal cancer. Autophagy . 2015;11(10):1939-40.
Share
Similar Post:
-
Meiosis: Definition, Stages, and Examples
Continue ReadingMeiosis Definition
Meiosis is defined as the process of cell division that results in the formation of a haploid “daughter” cell with the same haploid chromosomal number as the diploid “parent” (“original”) cell. After meiosis, the haploid cell would have just one portion of the parent cell’s multiple homologous chromosomal pairs.
What is Meiosis?
Meiosis is important because it decreases the number of chromosomes to half and allows for genetic diversity through genetic recombination and independent assortment.
Meiosis creates four haploid cells that may grow into potential gametes, resulting in a new individual with the complete number of genes when fertilisation occurs, preserving chromosomal number integrity over generations while increasing genetic variety and variability in population forms.
Meiosis comes from the Greek term meioun, which means “to diminish” (less).
The generation of gametes (egg cells or sperm cells) or spores is the primary purpose of meiotic division. The meiosis process occurs in the human body to reduce the number of chromosomes in a normal cell (46 chromosomes) to 23 chromosomes in eggs and sperm. As a result, the number of chromosomes in meiosis is cut in half.
As a result, when the two haploid cells merge during fertilisation, the number of chromosomes in the generated cell is restored as somatic cells (each with 46 chromosomes).
Meiosis is split into two stages: meiosis 1 and meiosis 2. Each component contains four stages (prophase, metaphase, anaphase, and telophase), which are identical to the four phases of mitosis.
The most complex portion of meiosis (i.e., meiosis I) is the initial part of the meiotic division. Because it comprises five substages: leptotene, zygotene, pachytene, diplotene, and diakinesis, prophase I takes roughly half the time it takes for meiosis. The chromosomes’ activity and structure change at each step, providing insight into prophase I’s intricacy.
Three major characteristics distinguish meiosis from mitosis:
1. Reverse recombination occurs during meiosis I. (also known as chiasma development or crossing across)
2. Meiosis I is characterised by the pairing of homologous chromosomes.
3. In Meiosis I, the cohesive sister chromatids are released in a two-step procedure.
On the mitotic spindle, these characteristics enable homologous segregation. The two sister homologous chromosomes separate during meiosis II. For the diverse events occurring in each meiosis stage, these varied chromosomal behaviours are detailed below. It’s also worth noting that these events are intertwined.
This indicates that distinct processes during chromosomal pairing, including reciprocal recombination, crossing-over, and chiasma formation, are linked. Hence, the only effective recombination mechanism during meiosis I prophase will be the one that provides proper homologous chromosome segregation at meiosis I.
The initial number of chromosomes is halved after the two subsequent chromosomal divisions. Meiosis I begins when the S phase is completed and the replication of the parent chromosome produces identical chromatids.
The chromosomes begin to couple together and eventually partition into two distinct cells. The chromatids, on the other hand, stay intact, and at the conclusion of meiosis I, each of the newly produced daughter cells will have one of the homologous chromosomes with two chromatids.
Meiosis II occurs after Meiosis I. After that, the two chromatids will split and form two daughter cells. As a result, four daughter haploid cells are formed at the end of meiosis II, each carrying one copy of each chromosome.
The pairing of homologous chromosomes after DNA replication not only allows for the segregation of meiotic chromosomes but also aids in the recombination of maternal and paternal chromosomes. This chromosomal pairing takes place during the prophase of meiosis I.
The first meiotic division (or meiosis I) and the second meiotic division (or meiosis II) are the two nuclear divisions that occur during meiosis (or meiosis II). The 4 key phases of meiosis are prophase, metaphase, anaphase, and telophase. They are also classified as I or II depending on whether they occur in meiosis I or II.
Meiosis Function
Consider this: if gametes (eggs and sperm) were generated only by mitotic division, rather than meiosis, the gametes would have the same number of chromosomes as diploid somatic cells. As a result, when the gametes unite during fertilisation, the resultant zygote will have four homologous chromosomal sets and will be tetraploid.
This “doubled chromosome content” situation will be passed down to future generations, resulting in chromosomal abnormalities. Throughout generations, the chromosomal number has fragmented and unkept. This is a chromosomal anomaly, to be sure.
Gametes are generated by the process of meiosis to keep the number of chromosomes constant in each generation. During the production of gametes, meiotic cell division reduces the number of chromosomes to haploid.
One cycle of chromosomal DNA replication precedes two rounds of nuclear division in meiosis. As a result of the parent cell’s meiotic division, four daughter nuclei (each of which is present in a new daughter cell) are generated.
Only a haploid number of chromosomes are found in each daughter cell nucleus. Gametes haploid cells are formed in two rounds: Meiosis I and II, with just one cycle of DNA replication (at the S phase of interphase).
Meiosis vs Mitosis
The two primary types of cell division are meiosis and mitosis. The distinctions between them are in mitosis only one nuclear division takes place and in meiosis two divisions. Meiosis produces haploid cell and they are sex cells, whereas in mitosis diploid cell are formed and are the somatic cells.
The end-product of mitosis is two daughter cells and in mitosis four daughter cells. Asexual reproduction takes place in mitosis and sexual reproduction in meiosis, thus crossing over takes place whereas in mitosis no crossing over is seen.
Phases of Meiosis
Meiosis is the process through which a parent diploid cell divides into four haploid cells. There really are two main phases of meiosis: meiosis I and meiosis II. Meiosis 1 is the first stage of meiotic division, often known as the reduction division of meiosis. This is due to the fact that the number of chromosomes is cut in half at this stage, resulting in the creation of haploid chromosomes.
In a process or occurrence known as a synapse, each pair of chromosomes comes close together to exchange a portion of their genetic material. This happens in the early phases of meiosis 1, especially during prophase I.
The homologous pairs of chromosomes come very close together and bond closely to each other during prophase 1 of meiosis I, and they virtually behave as one single unit. This unit is known as a bivalent or tetrad (indicating that each chromosome consists of two sister chromatids, so the sum of bivalent is four chromatids).
After aligning at the spindle equator, the bivalent separates into two pieces, allowing each chromosome to travel to the spindle pole on the opposing side. As a result, following meiosis I, each newly formed daughter nucleus is haploid, as it only carries one bivalent chromosome.
Meiosis II, the second stage of the meiosis cell cycle, is similar to mitosis in that it results in the formation of two daughter cells when the two chromatids separate.
As a result, meiosis I is the stage during which the meiosis cycle’s distinctive activities take place. Nonetheless, each step of the meiotic division, such as prophase, metaphase, anaphase, and telophase, is split in a manner that mimics the mitotic division.
The prophase of the first meiotic division, on the other hand, is far more complex and time-consuming than the prophase of mitosis. The prophase of the second meiotic division, on the other hand, is simpler and shorter.
Meiosis in a Nutshell
A cell’s chromosomes are replicated before it enters meiosis (during the interphase). The chromosomes condense along the nucleus’s centre during meiosis I and pair with their homologues during crossing over. The chromosomal pairs then split and travel to opposing ends of the cell.
For the first time, the cell splits into two cells. Both cells will go through meiosis II, when they will divide into two cells, each carrying one of each detached chromosome’s sister strands (chromatids), resulting in four genetically distinct haploid cells.
Meiosis Satges
Meiosis I occurs after interphase, when the chromosomes duplicate during the S phase of the cell cycle. During the early stages of prophase, I, the chromosomes condense. The cell’s two centrosomes go to the cell’s two opposing poles to prepare it for nuclear division.
Pairs of chromatids make up homologous chromosomes. After pairing, these chromosomes form bivalents in order to align at the spindle equator during metaphase I.
During anaphase, homologous chromosomes are separated from one another, but the two sister chromatids remain connected.
i. Prophase I
The most difficult phase of meiosis I is prophase I, which is split into five stages: leptotene, zygotene, pachytene, diplotene, and diakinesis.
The chromatin fibres condense into thread-like fibres at the Leptotene stage, resembling the established structure at the onset of mitosis.
The fibres are more condensed at the zygotene stage, allowing them to be recognised as distinct chromosomes. The bivalents arise when the pairs of chromosomes get firmly linked together as a result of synapsis.
The development of bivalent is crucial in the process of crossing over, which involves the exchange of DNA segments holding genetic material between two nearby chromosomes. During the pachytene stage, this procedure occurs. For gene recombination, the matching regions of chromosomes exchange genetic information.
During the pachytene stage, chromosomes are compressed to roughly a fifth of their original length. The two chromosomes of each bivalent split from one another at the centrosome during the diplotene stage. Chiasmata, which are links found when two homologous chromosomes swap DNA segments, keep the two chromosomes together.
Diplotene is characterised by the resumption of transcription, the de-condensation of chromosomes, and the temporary halt of meiosis. When the chromosomes are re-condensed to their maximal level of compaction at the start of prophase I’s last step, diakinesis, the centrosomes move even faster.
Only the chiasmata keep the chromosomes together. Spindles develop, nucleoli vanish, and the nuclear envelope vanishes at this point. Meiosis prophase 1 ends and meiosis metaphase 1 begins when the meiotic spindle begins to develop and the nucleoli begin to disintegrate.
ii. Metaphase I
After attaching to the microtubules with their kinetochores, the bivalents migrate to the equator of the spindle during this phase. This bivalent migration to the cell’s equator generally occurs only during meiosis I and not during mitotic division.
Each bivalent includes four chromatids, which means each bivalent also contains four kinetochores. These kinetochores appear to be in close proximity to one another, as though they are a single unit facing the same cell pole.
Each kinetochore can be attached to the microtubules of the spindle pole on the opposite side using this configuration. This arrangement is the initial step in preparing the chromosomes for separation during the anaphase that follows.
The paternal and maternal chromosomes are aligned on one pole of the cell at this time, and each newly created daughter cell will get a combination of paternal and maternal chromosomes during their migration to the opposing poles during anaphase.
iii. Anaphase I
The movement of homologous chromosomes to the spindle poles with the help of their kinetochore is the first step in anaphase. One of the key distinctions between meiosis and mitosis is this stage.
During mitosis, the sister chromatids are pushed to opposing poles, causing them to split. The two sister chromatids stay connected during meiosis, and following separation, the homologous chromosomes migrate toward the spindle poles.
As a result, by the end of meiotic anaphase I, each spindle pole contains a haploid number of chromosomes. During mitosis, chromatid separation is accomplished by cleaving the two sister chromatids using an active enzyme called separase.
To counteract separase’s activity during meiosis, the cell generates shugoshin, a protein that inhibits chromatid separation by shielding the centrosomal region of the chromosome where the cleavage occurs.
iv. Telophase I
Telophase 1 is the last phase of meiosis I, and it is marked by the movement of chromosomes to the spindle poles. Before cytokinesis, a nuclear membrane might have been created around chromosomes, resulting in two daughter cells with haploid sets of chromosomes. After the start of meiosis II, the chromosomes usually condense.
Results of Meiosis I
By the completion of meiosis, I, cytokinesis has aided in the development of two haploid nuclei cells. Each haploid cell’s chromosomes will be made up of two chromatids joined at the centromere.
Meiosis II Stages
Interphase meiosis occurs between the conclusion of meiosis I and the start of meiosis II. This stage is not connected with DNA replication since each chromosome already has two chromatids that have previously been replicated by the DNA synthesis process before the start of meiosis I.
In a nutshell, DNA is duplicated once before meiosis begins. Meiosis II, also known as second mitotic division, serves a similar goal as mitosis in that two new chromatids are orientated in two new daughter cells. As a result, the second meiotic division is also known as the meiotic division of separation.
i. Prophase II
Prophase II is the stage that occurs after meiosis I or interkinesis, and it is marked by the breakdown of the nuclear envelope and nucleolus, as well as the thickness and shortening of the chromatids, and centrosome replication and migration to the polar side. Prophase II is less complicated and shorter than prophase I, and it resembles the mitotic prophase in appearance.
Prophase II, on the other hand, differs from prophase I in that chromosomal crossing occurs only during prophase I and not during prophase II. At the completion of prophase II, metaphase II begins.
ii. Metaphase II
Metaphase II of meiotic division is identical to metaphase II of mitotic division, except that metaphase II has half the number of chromosomes and is distinguished by chromosomal alignment in the cell’s centre.
iii. Anaphase II
It is the stage after metaphase II, during which the sister chromatids split and migrate towards the cell poles. Anaphase II is similar to mitotic anaphase in that both involve chromatid separation. The shortening of the kinetochore causes sister chromatids to migrate to the cell’s two ends.
iv. Telophase II
Telophase II is the final stage of meiosis, in which four haploid cells are generated from the two cells produced during meiosis I. The newly formed cells’ nuclear membranes are fully established, and the cells are entirely separated at the conclusion of this phase.
However, sperm in humans and other animals are not completely functional at the conclusion of telophase II because they require the development of flagella to operate correctly.
Results of Meiosis II
After telophase II and cytokinesis, four haploid cells are formed, each of which has just one of the two homologous pairs of chromosomes. The genetic information from the maternal and paternal chromosomes is mixed in the haploid cells formed. These cells have a role in both the genetic variety of individuals within the same species and the evolution of animals.
Meiosis Examples
Meiosis is found in the life cycles of many creatures, including fungi, plants, algae, animals, and humans.
Meiosis can generate spores or gametes depending on the species, with gametes (sperm cells and egg cells) being produced in humans and other animals, while spores are produced in plants and algae.
Meiosis in Humans and Other Animals
In humans and other animals, meiosis generates haploid gametes. It is an important aspect of gametogenesis. Gametogenesis is the biological process of producing gametes, as the name suggests.
There are two types of gametogenesis in humans and other animals: spermatogenesis (the creation of male gametes, such as sperm cells) and oogenesis (the formation of female gametes, such as eggs) (formation of the female gamete, i.e., ovum or egg cell).
A diploid oocyte produces four haploid gamete cells during oogenesis. Only one cell survives to become an egg, while the other three become polar bodies.
This effect is caused by the oocyte’s uneven division during meiosis, in which one of the produced cells obtains the majority of the parent cell’s cytoplasm while the other generated cells degenerate, resulting in an increase in the concentration of nutrients in the formed egg. During prophase I of meiosis, the egg cell develops the majority of its specialised activities.
After meiosis and post-meiotic processes, such as spermiogenesis, when the sperm cell grows by obtaining a functioning flagellum and discarding much of its cytoplasm to form a compacted head, the sperm gets its specialised characteristics in order to develop into a functional gamete.
Meiosis is a process that happens throughout an organism’s reproductive period. However, in humans, meiotic division happens at various times. For example, in males, it begins during puberty and continues throughout their lives.
Females’ main oocytes will be stopped at prophase I by the time they reach adolescence, and they will proceed through the next phases of meiosis. However, each primary oocyte will cease at metaphase II of meiosis II when it develops into a secondary oocyte at ovulation.
Meiosis will only continue and finish during conception. Meiosis will stop if the secondary oocyte is not fertilised, and the arrested secondary oocyte will dissolve. Menstruation will start soon.
Meiosis in Plants and Algae
Plants and algae are multicellular creatures that produce both haploid and diploid cells throughout their lives. The haploid spores are generated by meiosis in this phenomenon known as alternation of generations. In plants and algae, this is also known as sporic meiosis.
The produced spores germinate and proceed through mitotic division, resulting in a haploid plant or algae. Because gametes are generated by mitotic division of already existing haploid cells, the haploid form is referred to as a gametophyte.
During fertilisation, the gametes unite to generate the diploid type of cells. Meiosis creates the spores from the diploid form. As a result, the diploid form is referred to as the sporophyte.
Meiosis in Fungi
In their life cycle, fungi have both asexual and sexual stages. The mycelium, for instance, may go through both sexual and asexual phases.
When haploid mycelia reach the sexual phase, they undergo plasmogamy (the union of two protoplasts) and karyogamy (the fusion of two protoplasts) (the fusion of two haploid nuclei). The development of the diploid zygote occurs after karyogamy.
The zygote develops into a stalked sporangium, which via meiosis produces haploid spores. Meiospores are the spores generated by meiosis, as opposed to mitospores, which are formed by mitosis. The sporangium will produce haploid spores (reproductive cells), each of which will germinate into a new mycelium.
Thus, in fungi, meiosis is the third step in the sexual phase’s sequential phases, which begin with plasmogamy and end with karyogamy. Meiosis is necessary for the fungus to return to its haploid stage.
Errors in Meiosis
Meiosis is prone to mistakes, which might have an impact on a person’s capacity to reproduce. Human longevity is severely harmed by abnormal meiosis. Infertility and the production of genetically unbalanced gametes can both be caused by errors in the meiosis stages.
Meiotic errors are the primary cause of congenital malformations as well as mental abnormalities in new born infants caused by genetic damage.
In more than 30% of human oocyte pachytene, errors in chromosomal pairing and recombination are present, resulting in a condition known as asynapsis, in which homologous chromosome pairing fails.
Failure of chromosomal pairing in yeast can cause cell death by triggering the cell’s checkpoints. A similar phenomenon may be seen in human germ cells. As a result of the rise in oocytes with chromosomal pairing faults, the number of germ cells will be depleted, resulting in early menopause in women.
Infertility results from mistakes in the phases of meiosis of spermatocyte development, as the quantity of functional sperm generated decreases.
Because a man generates around 300-400 million sperm each day, but a woman produces about 300-400 oocytes over her lifetime, depletion in the number of germ cells is more substantial in females than in males.
When chromosomal pairs fail to cross over properly during metaphase I, the unpaired chromosomes segregate randomly, increasing the chance of producing aneuploid gametes with an unbalanced number of chromosome copies. Furthermore, due to unsuccessful crossing-over, spermatocytes may be destroyed by apoptosis or necrosis.
Biological Importance of Meiosis
Because the balance between the number of chromosomes that are doubled during fertilisation and the halving of chromosomes during gamete production is maintained, meiosis and mitosis are two critical phases of the cell cycle for any organ that reproduces sexually.
A sexually reproducing organism’s cell cycle is divided into two distinct phases: haploid and diploid.
The haploid phase of meiosis begins with gamete creation and concludes with the development of a zygote during fertilisation, whereas the diploid phase begins with the formation of a zygote by the fusing of two gametes and terminates with meiotic cell division during gamete formation.
To complete the life cycle of sexually reproduced creatures such as humans and animals, meiotic division creates four haploid cells from one diploid cell.
The chromosomal DNA doubles in the parent diploid cell before meiosis, and four haploid nuclei are produced as a result of two subsequent diploid nucleus divisions.
Meiosis is physiologically significant since it is responsible for sexually reproduced organisms’ genetic variety, when the chromatids of two homologous chromosomes synapse and exchange portions of their genetic content during prophase I.
Meiosis is important because it decreases the number of chromosomes by half and allows for genetic diversity through genetic recombination and independent assortment.
Meiosis creates four haploid cells that may grow into potential gametes when fertilisation occurs, resulting in a new individual with the complete number of genes when fertilisation occurs, preserving chromosomal number integrity over generations while increasing genetic variety and variability in population forms.
Meiosis Citations
Share
Similar Post:
